View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_high_15 (Length: 260)
Name: NF9833_high_15
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 24104542 - 24104766
Alignment:
| Q |
17 |
tgttggtgtcattttcaagctattttgagttttcattgtcttttggtgatggaaatgggttggcttttgttatggttccaaagggttatgaaggtaaggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
24104542 |
tgttggtgtcattttcaagctattttgagttttcattgtcttttggtgatggaaatgggttggcttttgttatggttccaaagggttatgaaggtgaggt |
24104641 |
T |
|
| Q |
117 |
ttttggtaatgattctgttgtgttgaagaagaagaaggattctagggttgttgctgttcagtttcttgcttcaagagatgttagaaataagagttctgat |
216 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24104642 |
ttttggtaatgattcttttgggtt---gaagaagaaggattctaaggttgttgctgttgagtttcttgcttcaagagatgttagaaataagagttctgat |
24104738 |
T |
|
| Q |
217 |
agttttggtatggctattgatgttggtg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
24104739 |
agttttggtatggctattgatgttggtg |
24104766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University