View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_high_5 (Length: 353)
Name: NF9833_high_5
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_high_5 |
 |  |
|
| [»] scaffold1250 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1250 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: scaffold1250
Description:
Target: scaffold1250; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 12 - 335
Target Start/End: Complemental strand, 1409 - 1085
Alignment:
| Q |
12 |
atagggaacagatgaaggacaaggtcgagggattgataaatctatgtgttttagatgaagtcatgtatcatatcctggaggtttgggataaattggaaag |
111 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1409 |
atagggaacagatgaaggacaaggtcgcgggattgataaatctatgtgttttagatgaagtcatgtataatatcctggaggtttgggataaattggaaag |
1310 |
T |
 |
| Q |
112 |
tcactatatgacaaagacgttgatgaacaaattgttcgcgaaacaacgactatagagtctgcagatgcaggaat-gtttgatttgcaacagcacgtcaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1309 |
tcactatatgacaaagacgttgatgaacaaattgttcgcgaaacaacgactatacagtctgaagatgcaggaatggtttgatttgcaacagcacgtcaat |
1210 |
T |
 |
| Q |
211 |
gtcttcaacactatagtcgctgatttggtgaggcttgagggtgaaaattgatgacgtagatatggctgttatttttctgtgctcgttacccagttcttat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1209 |
gtcttcaacactatagtcgctgatttggtgaggcttgagggtgaaaattgatgacgtagatatggctgttatttttctgtgctcgttacccagttcttat |
1110 |
T |
 |
| Q |
311 |
gatcacctggtgaccactcttacct |
335 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
1109 |
gatcacctggtgactactcttacct |
1085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University