View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_19 (Length: 392)
Name: NF9833_low_19
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 387
Target Start/End: Complemental strand, 388251 - 387884
Alignment:
| Q |
19 |
actaattggtgatggtgatgacggcattgatctccacgatggttctctcttaatagttaccgaaggagaataataaggtgcggtactggaagtgtctgag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388251 |
actaattggtgatggtgatgacggcattgatctccacgatggttctctcttaatagttaccgaaggagaataataaggtgcggtactggaagtgtctgag |
388152 |
T |
|
| Q |
119 |
aatgagaatggttttggagatggagagtatatttctccaacaagaagccgttctccgaagatggctacggcttctttgacggagctgaaaggacgagagg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
388151 |
aatgagaatggttttggagatggagagtatatttctccaacaagaagccgttctccgaagatggctacggcttctttgacggagctgaaaggacgagagg |
388052 |
T |
|
| Q |
219 |
tgtccacggtggagctataatcagcggtaggggtcaccgacataggttcatgttccattgtannnnnnnnnnnnnnnnnnnnnaaggatatgggaattgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
388051 |
tgtccacggtggagctataatcagcggtaggggtcaccgacataggttcatgttccattgta-tttgttttgtttgttgaaggaaggatatgggaattgt |
387953 |
T |
|
| Q |
319 |
tatgatcagtactagtatttgtttgaagccaggttggtgttttaattaattgttggtttctctgcttct |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
387952 |
tatgatcagtactagtatttgtttgaagccaggttggtgttttaattaattgttggtttctttgcttct |
387884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University