View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_31 (Length: 326)
Name: NF9833_low_31
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 9 - 313
Target Start/End: Complemental strand, 6528864 - 6528560
Alignment:
| Q |
9 |
agcataggaatatataaaagcatgtattattcgaaagaaaaatactagcaacacactctaattcattaattctttagggaatgtccaacaccggggctat |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6528864 |
agcattggaatatataaaagcatgtattattcgaaagaaaaatactagcaacacactctaattcattaattctttagggaatgtccaacaccggggctat |
6528765 |
T |
|
| Q |
109 |
gtcccggggttgttggtcgaaaagcttcaacggatccctctagatttctaccattattctgcaactgccttgggctcaaaacaacacttctcgtcattgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6528764 |
gtcccggggttgttggtcgaaaagcttcaacggatccctctagatttctaccattattctgcaactgccttgggctcaaaacaacacttctcgtcattgt |
6528665 |
T |
|
| Q |
209 |
ctcgaccgaggcagctttgggtgaaccaatgctctttctcaaacttcttccttctatggagagtagttcacatgaaatcaacaagagtacaaagatcaaa |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6528664 |
ctcgaccgaggcagctttgggtgaaccaatgctctttctcaaacttcttccttctatggagagtagttcacatgaaatcaacaagagtacaaagatcaaa |
6528565 |
T |
|
| Q |
309 |
caact |
313 |
Q |
| |
|
||||| |
|
|
| T |
6528564 |
caact |
6528560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University