View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_42 (Length: 301)
Name: NF9833_low_42
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 10 - 287
Target Start/End: Complemental strand, 935185 - 934908
Alignment:
| Q |
10 |
gcaaaggttgagaaggtgagtattgatgcagttgttgctgttcctgctcctgttgaggtggaatcgattgatggcttggaaggcaagaaaaggtgtgctt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
935185 |
gcaaaggttgagaaggtgagtattgatgcagttgttgctgttcctgctcctgttgaggtggaatcgattgatggcttggaaggcaagaaaaggtgtgctt |
935086 |
T |
 |
| Q |
110 |
gggttacaccaaatacaggtatcttcattcctttgtaatcatgattaacttagaatattgtgatttgtgatattggtattatttgtttgaacttttaatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
935085 |
gggttacaccaaatacaggtatcttcattcctttgtaatcatgattaacttagaatattgtgatttgtgatattggtattatttgtttgaacttttaatg |
934986 |
T |
 |
| Q |
210 |
taattgtaaggttgaattgtaacttgtaattaacttcaatgtagacaatgagatatttgttttatatgatacaaaagt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
934985 |
taattgtaaggttgaattgtaacttgtaattaacttcaatgtagacaatgagatatttgttttatatgatacaaaagt |
934908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University