View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_44 (Length: 283)
Name: NF9833_low_44
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 165 - 273
Target Start/End: Complemental strand, 50610505 - 50610396
Alignment:
| Q |
165 |
tcaaaaaatgggatttatatagctggagagaga--agatactaggaagaagagaagtggaagccttacccaccgacagttggcaacactgctgcatttca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50610505 |
tcaaaaaatgggatttatatagctggagagagagaagatactaggaagaagagaagtggaagccttacc-accgacagttggcaacactgctgcatttca |
50610407 |
T |
 |
| Q |
263 |
cacactctctg |
273 |
Q |
| |
|
||||||||||| |
|
|
| T |
50610406 |
cacactctctg |
50610396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 50610647 - 50610553
Alignment:
| Q |
19 |
aggtaggtacctttgatgaaaagagaagaaacccaagatccgatgaggggacaaagagcataagagacggacactcactcacaggaaactgctgc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50610647 |
aggtaggtacctttgatgaaaagagaagaaacccaagatccgatgaggggacaaagagcataagagacggacactaactcacaggaaactgctgc |
50610553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University