View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_49 (Length: 254)
Name: NF9833_low_49
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_49 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 12 - 161
Target Start/End: Original strand, 30726974 - 30727121
Alignment:
| Q |
12 |
agcagagacttagcacttcttagaaacccactcactaatttcttgtgttgcctgtaaaagaacaaaactttattagggcaaaatcacgtatactaactac |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30726974 |
agcatagacttagcacttcttagaaacccactcactaatttcttgtgttgcctgtaaaagaacaaaactttattagggcaaaatcacgtatactaacta- |
30727072 |
T |
|
| Q |
112 |
nnnnnnnnnntgttgaaataacaatgcaaattagagtttcttgatgatca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30727073 |
-gaaaaaaaatgttgaaataacaatgcaaattagagtttcttgatgatca |
30727121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 210 - 254
Target Start/End: Original strand, 30727170 - 30727214
Alignment:
| Q |
210 |
caatggaaattggagaagggagaaataattttgattacaaagcaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30727170 |
caatggaaattggagaagggagaaataaatttgattacaaagcaa |
30727214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University