View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_52 (Length: 251)
Name: NF9833_low_52
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_52 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 66 - 214
Target Start/End: Complemental strand, 12149390 - 12149242
Alignment:
| Q |
66 |
gagttctacacattccattaatgtagttctcaaaatgatgatgacatgtactacatatgctaattgggagtgtnnnnnnnttactttccctcctaaaaat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12149390 |
gagttctacacattccattaatgtagttctcaaaatgatgatgacatgtactacatatgctaattgggagtgtaaaaaaattactttccctcctaaaaat |
12149291 |
T |
 |
| Q |
166 |
aactaaattgggcttaaactaccttagtttagccacaatgaatttacat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12149290 |
aactaaattgggcttaaactaccttagtttagccacaatgaatttacat |
12149242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 50
Target Start/End: Complemental strand, 12149446 - 12149409
Alignment:
| Q |
13 |
aagggaacccaaatatctcccaaggttacatgcaagtg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12149446 |
aagggaacccaaatatctcccaaggttacatgcaagtg |
12149409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University