View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_58 (Length: 249)
Name: NF9833_low_58
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 19122848 - 19123083
Alignment:
| Q |
1 |
aattgtgggatagtgtatcagcttgattttacattccttcattcttgtaggcaaccatttt-ttctagtgaacatggtgccctggtcggttgtaatggtt |
99 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19122848 |
aattgggggatagtgtatgagcttgattttacattccttcattcatgtaggcaaccatttttttctagtgaacatggtgccctagtcggttgtaatggtt |
19122947 |
T |
|
| Q |
100 |
tttaggattcctaatcgatacatgatctgatgtaatattaaacgaataatatcctccagtccaatacttttaatcggttgagcttctacccattttatga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19122948 |
tttaggattcctaatcgatacatgatctgatgtaatattaaacaaataatatcctccagtccaatacttttaatcggttgagcttctacccattttatga |
19123047 |
T |
|
| Q |
200 |
aataatcaatggcaacgaggacgaagctatgtttct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19123048 |
aataatcaatggcaacgaggacgaagctatgtttct |
19123083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University