View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9833_low_61 (Length: 245)

Name: NF9833_low_61
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9833_low_61
NF9833_low_61
[»] chr4 (3 HSPs)
chr4 (104-206)||(2243095-2243197)
chr4 (61-110)||(2243682-2243731)
chr4 (217-245)||(41316250-41316278)
[»] chr1 (1 HSPs)
chr1 (214-245)||(52331759-52331790)
[»] chr3 (1 HSPs)
chr3 (216-245)||(2439764-2439793)
[»] chr8 (1 HSPs)
chr8 (217-245)||(3305971-3305999)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 104 - 206
Target Start/End: Complemental strand, 2243197 - 2243095
Alignment:
104 ttttgagcaaacatgaatagtctgcagagttatgaagcccagatactccaaaacagatatgtaaccatatcggattcgaatactcgcgaatacgtagcca 203  Q
    ||||||||||||||||| |||||  ||||||||||||| |  |||||||||||| ||||| ||  | ||| ||||  ||||||||||||||||||| |||    
2243197 ttttgagcaaacatgaagagtctatagagttatgaagctcgaatactccaaaacggatatatactcgtattggatatgaatactcgcgaatacgtaccca 2243098  T
204 tga 206  Q
    |||    
2243097 tga 2243095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 61 - 110
Target Start/End: Complemental strand, 2243731 - 2243682
Alignment:
61 gttgagtgagtttgagagaacgagaggaaagttgagaacggttttttgag 110  Q
    ||||| |||| |||||||||||||||||||||||||||||||| ||||||    
2243731 gttgaatgaggttgagagaacgagaggaaagttgagaacggttctttgag 2243682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 217 - 245
Target Start/End: Complemental strand, 41316278 - 41316250
Alignment:
217 ttttaggcttaaatattgcactcgtccct 245  Q
    |||||||||||||||||||||||||||||    
41316278 ttttaggcttaaatattgcactcgtccct 41316250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 214 - 245
Target Start/End: Complemental strand, 52331790 - 52331759
Alignment:
214 ttattttaggcttaaatattgcactcgtccct 245  Q
    ||||||||||||||||||||||||||||||||    
52331790 ttattttaggcttaaatattgcactcgtccct 52331759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 216 - 245
Target Start/End: Original strand, 2439764 - 2439793
Alignment:
216 attttaggcttaaatattgcactcgtccct 245  Q
    ||||||||||||||||||||||||||||||    
2439764 attttaggcttaaatattgcactcgtccct 2439793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 217 - 245
Target Start/End: Complemental strand, 3305999 - 3305971
Alignment:
217 ttttaggcttaaatattgcactcgtccct 245  Q
    |||||||||||||||||||||||||||||    
3305999 ttttaggcttaaatattgcactcgtccct 3305971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University