View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_67 (Length: 241)
Name: NF9833_low_67
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_67 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 10796851 - 10797075
Alignment:
| Q |
19 |
tttaggctagtaatcatcttatttaacaagaaatattcttaatcttaattagcttataaaaaattcttaatttcatctaaacattggaattgggaaacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10796851 |
tttaggctagtaatcatcttatttaacaagaaatattcttaatcttaattagcttataaaatattcttaatttaatctaaacattggaattgggaaacaa |
10796950 |
T |
|
| Q |
119 |
cagtatcatattcataaaccacac--acaatgcatgaaattgtaatggaaataaaccttggtaaagatgacaacaacacattccataacaagcttagtta |
216 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10796951 |
cagtatcatattcataaatcacacagacaatgcatgaaattgtaatggaaataaaccttggtaaagatgacaacaacacactccataacaagcttagtta |
10797050 |
T |
|
| Q |
217 |
agaacaaatcatcagccaacaacct |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10797051 |
agaacaaatcatcagccaacaacct |
10797075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University