View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_70 (Length: 233)
Name: NF9833_low_70
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_70 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 82 - 211
Target Start/End: Complemental strand, 3019011 - 3018882
Alignment:
| Q |
82 |
attttgaagagaaaaccaaaatggtggaatggattgcaaggttggccaagatgggtactaggtacatgattgagtgagggtatgtttgtaaatacatttg |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3019011 |
attttgaagagaaaaccaaaatggtggaatggattgcaaggttggccaagatgggtactaggtacatgattgagtgagggtatgtttgtaaatacatttg |
3018912 |
T |
|
| Q |
182 |
tttctgtgtttggtagtttctttctttctt |
211 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
3018911 |
tttctgtttttggtagtttctttctttctt |
3018882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 3019050 - 3019011
Alignment:
| Q |
16 |
agagaaatggtggataaatttgctcaagtactctatgcca |
55 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3019050 |
agagaaatggtggataactttgctcaagtactctatgcca |
3019011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University