View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_77 (Length: 223)
Name: NF9833_low_77
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_77 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 7414694 - 7414504
Alignment:
| Q |
18 |
attagttaaggtgaagctgggggatttaattactcattatatgattatgatgttggtttgttttttgttgactacatttggaaagggttgggggtatata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7414694 |
attagttaaggtgaagctgggggatttaattactcattatatgattatgatgttggtttgttttttgttgactacatttggaaagggttgggggtatata |
7414595 |
T |
|
| Q |
118 |
atcatggtatagaagagtgggagataannnnnnncgctttgactttggatgattaatttgtgtatgtgtgattggtttagtttagtttggt |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7414594 |
atcatggtatagaagagtgggagataatttttttcgctttgactttggatgattaatttgtgtatgtgtgattggtttagtttagtttggt |
7414504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University