View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9833_low_78 (Length: 222)

Name: NF9833_low_78
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9833_low_78
NF9833_low_78
[»] chr2 (1 HSPs)
chr2 (112-204)||(13714013-13714105)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 112 - 204
Target Start/End: Original strand, 13714013 - 13714105
Alignment:
112 atgggaatagctcctcttttagtggctgcttcaaaattctcttttctaacaactccaatatgacccctttccacttgaataggtgagacacat 204  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13714013 atggaaatagctcctcttttagtggctgcttcaaaattctcttttctaacaactccaatatgacccctttccacttgaataggtgagacacat 13714105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University