View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9833_low_82 (Length: 206)
Name: NF9833_low_82
Description: NF9833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9833_low_82 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 14653557 - 14653389
Alignment:
| Q |
17 |
agaggcaactcagtgaataagggaagctagttcattctttagtgactactgatatatgatcatatatattaaggaaagctattgccattagcnnnnnnnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14653557 |
agaggcaactcagtgaataagggaagctagttcattctttagtgactactgatatatgatcatatattttaaggaaagctattgccattagctttttttc |
14653458 |
T |
|
| Q |
117 |
ccttgttgatttttgttacattgacagctagtttaccttccgaactgtgccttattcgaaaatggtatc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14653457 |
ccttgttgatttttgttacattgacagctagtttaccttccgaactgtgccttattcgaaaatggtatc |
14653389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 185
Target Start/End: Complemental strand, 14663348 - 14663180
Alignment:
| Q |
17 |
agaggcaactcagtgaataagggaagctagttcattctttagtgactactgatatatgatcatatatattaaggaaagctattgccattagcnnnnnnnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14663348 |
agaggcaactcagtgaataagggaagctagttcattctttagtgactactgatatatgatcatatattttaaggaaagctattgccattagctttttttc |
14663249 |
T |
|
| Q |
117 |
ccttgttgatttttgttacattgacagctagtttaccttccgaactgtgccttattcgaaaatggtatc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14663248 |
ccttgttgatttttgttacattgacagctagtttaccttccgaactgtgccttattcgaaaatggtatc |
14663180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 14706935 - 14706997
Alignment:
| Q |
27 |
cagtgaataagggaagctagttcattctttagtgactactgatatatgatcatatatattaag |
89 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14706935 |
cagtgaataaggaaagctagttcattctttagtgactactgatatatgatcatatattttaag |
14706997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 125 - 182
Target Start/End: Original strand, 14707105 - 14707162
Alignment:
| Q |
125 |
atttttgttacattgacagctagtttaccttccgaactgtgccttattcgaaaatggt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
14707105 |
atttttgttacattgacagctagtttaccttccgaactgtgccttatgcaaaaatggt |
14707162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 125 - 185
Target Start/End: Complemental strand, 14668814 - 14668754
Alignment:
| Q |
125 |
atttttgttacattgacagctagtttaccttccgaactgtgccttattcgaaaatggtatc |
185 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
14668814 |
atttttgttacattgacaactattttaccttccgaattgtgccttatgcgaaaatggtatc |
14668754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 14668972 - 14668931
Alignment:
| Q |
26 |
tcagtgaataagggaagctagttcattctttagtgactactg |
67 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14668972 |
tcagtgaataaggcaagccagttcattctttagtgactactg |
14668931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University