View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9835_high_8 (Length: 237)
Name: NF9835_high_8
Description: NF9835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9835_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 30334790 - 30334575
Alignment:
| Q |
1 |
accgataagttcatatgcatggattaaatatttcatgcaaatgtttcctttgaatattgttctttttagaactgttagtatgaaattctcataatctaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30334790 |
accgataagttcatatgcatggattaaatatttcatgcaaatgtttcctttgaatattgttctttttagaactgttagtatgaaattctcataatctaaa |
30334691 |
T |
|
| Q |
101 |
cgtaattttgctctgtagacatgtatactatttattactttttaactttatgttagctttgattatcttaaatccaagttgaaaaggaagacaaattctt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30334690 |
cgtaactttgctctgtagacatgtatactatttattactttttaactttatgttagctttgattatcttaaatccaagtt-aaaaggaagacaaattctt |
30334592 |
T |
|
| Q |
201 |
agttgatactgtttgtt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
30334591 |
agttgatactgtttgtt |
30334575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University