View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9835_low_17 (Length: 247)
Name: NF9835_low_17
Description: NF9835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9835_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 2941101 - 2941340
Alignment:
| Q |
1 |
cctttccttcctatgtagggaccacttgtcctaaaatcttcgtttgttactaggatcatcggatgattgctaataactctacattagtttgactagaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2941101 |
cctttccttcctatgtagggaccacttgtcctaaaatcttcgtttgttactaggatcattggatgattgctaataactctacattagtttgactagaagt |
2941200 |
T |
|
| Q |
101 |
ggtaaacaatagcttttgcattggattgaaaaatttacactaagttttacatcaaacttgtaaaaacaaccaaacataagttatctcacttcaaactcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2941201 |
ggtaaacaatagcttttgcattggattgaaaaatttacactaagttttacatcaaacttgtaaaaacaaccaaacataagttatctcacttcaaactcaa |
2941300 |
T |
|
| Q |
201 |
ttgcaactaatttgtcatacaaaatcacttttatcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2941301 |
ttgcaactaatttgtcatacaaaatcacttttatcctatg |
2941340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 160
Target Start/End: Original strand, 46604552 - 46604624
Alignment:
| Q |
86 |
agtttgactagaagtggtaaacaatagcttttgcattggattgaaaaatttacactaagttttacatcaaacttg |
160 |
Q |
| |
|
||||||||| ||| | |||| |||||||||||||||| ||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
46604552 |
agtttgacttgaaataataaaaaatagcttttgcattg--ttggaaaattcacaataagttttacatcaaacttg |
46604624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 156
Target Start/End: Original strand, 6986808 - 6986840
Alignment:
| Q |
124 |
gattgaaaaatttacactaagttttacatcaaa |
156 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
6986808 |
gattgaaaaatttacactaaattttacatcaaa |
6986840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University