View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9835_low_20 (Length: 240)
Name: NF9835_low_20
Description: NF9835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9835_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 38875192 - 38874970
Alignment:
| Q |
1 |
cttcgcccctgaccctccacgacacttttctgctgtctcacagcctctttgatatgtgtttgccggtttctggttgcagctgcctggatcttttttgctg |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38875192 |
cttcgcccctggccctccacgacacttttcttctgtctcacagcctctttgatatgtgtttgtcggtttctggttgcagctgcctggatcttttttgctg |
38875093 |
T |
|
| Q |
101 |
catgtgatagtgtctctttccattgcaggattaccgataacattgccagcctcaacgtcttgagttacaaatgtgcaaatcaaaagagcactaaggaaca |
200 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38875092 |
catgggatagtgtctctttgcattgcaggattactgataacattgccagcctcaacgtcttgagttacaaatgtgcaaatcaaaagagcactaaggaacg |
38874993 |
T |
|
| Q |
201 |
caaccaatgttgtctttgtcatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38874992 |
caaccaatgttgtctttgtcatt |
38874970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 22 - 223
Target Start/End: Original strand, 38782645 - 38782846
Alignment:
| Q |
22 |
acacttttctgctgtctcacagcctctttgatatgtgtttgccggtttctggttgcagctgcctggatcttttttgctgcatgtgatagtgtctctttcc |
121 |
Q |
| |
|
|||||| ||| || ||||||| ||||| |||||||||||||||| |||||||||||||||||| | || || |||||| |||||||||||||| | |
|
|
| T |
38782645 |
acacttgtcttctatctcacatcctctctgatatgtgtttgccgaaactgggttgcagctgcctggatttcttctgttgcatgggatagtgtctctttgc |
38782744 |
T |
|
| Q |
122 |
attgcaggattaccgataacattgccagcctcaacgtcttgagttacaaatgtgcaaatcaaaagagcactaaggaacacaaccaatgttgtctttgtca |
221 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||| | || |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38782745 |
attgcaggattaccgataatattgacagcctcaacatcttgagtaaaaagtgtgcaaatcaaaagagcactaagaaacacaaccaatgttgtctttgtca |
38782844 |
T |
|
| Q |
222 |
tt |
223 |
Q |
| |
|
|| |
|
|
| T |
38782845 |
tt |
38782846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 38872019 - 38871808
Alignment:
| Q |
13 |
ccctccacgacacttttctgctgtctcacagcctctttgatatgtgtttgccggtttctggttgcagctgcctggatcttttttgctgcatgtgatagtg |
112 |
Q |
| |
|
|||||| || ||| ||||| || ||||||| ||||| | |||||||||||||| | |||| ||||||||||||| | || || || ||| ||||||| |
|
|
| T |
38872019 |
ccctccgcggcacctttcttctctctcacatcctctcttatatgtgtttgccgaaaccgggttacagctgcctggatttcttctgttgtatgggatagtg |
38871920 |
T |
|
| Q |
113 |
tctctttccattgcaggattaccgataacattgccagcctcaacgtcttgagttacaaatgtgcaaatc-aaaagagcactaaggaacacaaccaatgtt |
211 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| ||||||| || |||||||||| || |||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38871919 |
tctctttgcattgcaggattaccgataaaattgacagcctcgacatcttgagttaaaagtgtggaaatcaaaaagagcactaaggaacacaaccaatgtt |
38871820 |
T |
|
| Q |
212 |
gtctttgtcatt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38871819 |
gtctttgtcatt |
38871808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University