View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9835_low_25 (Length: 223)
Name: NF9835_low_25
Description: NF9835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9835_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 54 - 107
Target Start/End: Original strand, 21695315 - 21695368
Alignment:
| Q |
54 |
tgtgtcaatatttttcatttcgaattagatgacaagaaaaatgatatagaagag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21695315 |
tgtgtcaatatttttcatttcgaattagatgacaagaaaaatgatatagaagag |
21695368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University