View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9836_high_20 (Length: 256)

Name: NF9836_high_20
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9836_high_20
NF9836_high_20
[»] chr5 (1 HSPs)
chr5 (18-120)||(2482446-2482548)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 120
Target Start/End: Complemental strand, 2482548 - 2482446
Alignment:
18 attacttatgtgggattcattcattttagttgtgtccttttctcattcatatagcaggaccatgtcatgttcaaattcatttataataagagaggcctct 117  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2482548 attacttatgtgggattcattaattttagttgtgtccttttctcattcatatagcaggaccatgtcatgttcaaattcatttataataagagaggcctct 2482449  T
118 ggt 120  Q
    |||    
2482448 ggt 2482446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University