View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_high_20 (Length: 256)
Name: NF9836_high_20
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 120
Target Start/End: Complemental strand, 2482548 - 2482446
Alignment:
| Q |
18 |
attacttatgtgggattcattcattttagttgtgtccttttctcattcatatagcaggaccatgtcatgttcaaattcatttataataagagaggcctct |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2482548 |
attacttatgtgggattcattaattttagttgtgtccttttctcattcatatagcaggaccatgtcatgttcaaattcatttataataagagaggcctct |
2482449 |
T |
 |
| Q |
118 |
ggt |
120 |
Q |
| |
|
||| |
|
|
| T |
2482448 |
ggt |
2482446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University