View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_high_23 (Length: 250)
Name: NF9836_high_23
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_high_23 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 2481882 - 2482121
Alignment:
| Q |
11 |
cacagacatacacacactcttgcccatctatacaagtagtacctgcagagttatacttttgtggcttaaccactggaatttaatttccgtagctaactct |
110 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2481882 |
cacagacaaacacacactcttgcccatctatacaagtagtacctgcagagttatacttttgtggcttaaccactggaatttaatttccgtagctaactct |
2481981 |
T |
 |
| Q |
111 |
ctgcatatgtcacatgtatcggataaatgtattctctgcaagttcgtccccttcttgatgattatttgtatccaaatcctgattggttgttgtagttaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2481982 |
ctgcatatgtcacatgtatcggataaatgtattctctgcaagttcgtccccttcgtgatgattatttgtatccaaatcctgattggttgttgtaattaac |
2482081 |
T |
 |
| Q |
211 |
gtaacgggtgaggcctgatgtgctgcatttatagaacacc |
250 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2482082 |
gtaacgggtgaggcctgatttgctgcatttatagaacacc |
2482121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University