View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_high_24 (Length: 248)
Name: NF9836_high_24
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 136 - 238
Target Start/End: Original strand, 38980048 - 38980150
Alignment:
| Q |
136 |
gcaagtggaagctcttcttcatctgcagcttcaaccatcatcaacagtcccaacagtagcagccgctatgagaaccagaaacgccgtgactggaacacct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38980048 |
gcaagtggaagctcttcttcatctgcagcttcaaccatcatcaacagtcccaacagtagcagccgctatgagaaccagaaacgccgtgactggaacacct |
38980147 |
T |
 |
| Q |
236 |
ttg |
238 |
Q |
| |
|
||| |
|
|
| T |
38980148 |
ttg |
38980150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 38979916 - 38979984
Alignment:
| Q |
1 |
attttcatggattcaatacaagaatttatagagacatgtaacaatgaaaacttgacctgcaacttcatg |
69 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38979916 |
attttcatggattcaattcaagaatttatagggacatgtaacaatgaaaacttgacctgcaacttcatg |
38979984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 193 - 238
Target Start/End: Original strand, 51438874 - 51438919
Alignment:
| Q |
193 |
agcagccgctatgagaaccagaaacgccgtgactggaacacctttg |
238 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51438874 |
agcagccgctatgaaaaccagaaacgccgtgactggaacacctttg |
51438919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 30504549 - 30504504
Alignment:
| Q |
193 |
agcagccgctatgagaaccagaaacgccgtgactggaacacctttg |
238 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
30504549 |
agcagccgctatgaaaaccagaaacgccgtgactggaacacttttg |
30504504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University