View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_45 (Length: 285)
Name: NF9836_low_45
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_45 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 10590395 - 10590649
Alignment:
| Q |
1 |
atgacatgaaaaacaaataaagtgccacttgtttttcatgaattgcattgcatggttagcaagttccaacggaacatggtgggagcagatttgattgcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10590395 |
atgacatgaaaaacaaataaagtgccacttgtttttcatgaattgcgttgcatggttagcaagttccaacggaacatggtgggagcagatttgattgcac |
10590494 |
T |
 |
| Q |
101 |
aaaaacaaaaatggttgatatttataaattataagcacttggacgtattgtgttgggacaaaatttctttgtgggatatatgtttgagttccgtttcatg |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10590495 |
aataacaaaaatggttgatatttataaattataagcacttggacgtattgtgttgggacaaattttctttgtgggatatatgtttgagttccatttcatg |
10590594 |
T |
 |
| Q |
201 |
tgattggcaatcaattgttttaaaataa--gcaatatattatagatgcatatcta |
253 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
10590595 |
tgattggcaatcaattgttttaaaataaacgatatatattatagatgcatatcta |
10590649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University