View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_49 (Length: 266)
Name: NF9836_low_49
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_49 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 34571427 - 34571673
Alignment:
| Q |
8 |
ttggtgttaggcaccggatacaccttca------atctgaaagtgtcggtgcaacatagatttacggtgataacaagtacaataatagtaggttcaaata |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571427 |
ttggtgttaggcaccggatacaccttcaatttcaatctgaaagtgtcggtgcaacatagatttacggtgataacaagtacaataatagtaggttcaaata |
34571526 |
T |
|
| Q |
102 |
acatgcttacccatttgaaatctagcttgcacaaaatgagataccatatgataaacacgctccaactggataactaaaattccacttgttactagttctc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571527 |
acatgcttacccatttgaaatctagcttgcacaaaatgagataccatatgataaacacgctccaactggataactaaaattccacttgttactagttctc |
34571626 |
T |
|
| Q |
202 |
ctaagctatctggcagttcgatccctctaaattccaatccccgaggt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34571627 |
ctaagctatctggcagttcgatccctctaaattccaatccccgaggt |
34571673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University