View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_53 (Length: 253)
Name: NF9836_low_53
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 5372357 - 5372589
Alignment:
| Q |
18 |
actactagttggagaagctatcactcaaacgtctcaaatctcaattattggaccatttcttgtctattcagaaattcatcttcttctttttaacttttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5372357 |
actactagttggagaagctatcactcaaacgtctcaaatctcaattattggaccatttcttgtctattcagaaattcatcttcttctttttaacttttaa |
5372456 |
T |
 |
| Q |
118 |
ctactaatgactattatcaacagtgtcttagcaactctgatttaaccactgcctttacatacagtttataggttacaaatttacaattttgcacagttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5372457 |
ctactaatgactattatcaacagtgtcttagcaactctgatttaaccactgcctttacatacagtttataggttacaaatttacaattttgcacagttct |
5372556 |
T |
 |
| Q |
218 |
ttacggatatatagggtgacacaacacgaaact |
250 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| |
|
|
| T |
5372557 |
ttacggatatatagggtgacacaatatgaaact |
5372589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University