View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_54 (Length: 253)
Name: NF9836_low_54
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 3305163 - 3305287
Alignment:
| Q |
1 |
agtagtacccttggtatgaatgtcatcgtcatcatcttcttcggcgaagagagatgatgtagagaagagagctatgtccatttgttagttcctttcttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3305163 |
agtagtacccttggtatgaatgtcatcgtcatcatcttcttcggcgaagagagatgatgtggagaagagagctatgtccatttgttagttcctttcttgt |
3305262 |
T |
 |
| Q |
101 |
caatcacagtcaccaactcttgaat |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3305263 |
caatcacagtcaccaactcttgaat |
3305287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University