View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9836_low_65 (Length: 244)

Name: NF9836_low_65
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9836_low_65
NF9836_low_65
[»] chr4 (1 HSPs)
chr4 (22-244)||(49764852-49765076)


Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 22 - 244
Target Start/End: Original strand, 49764852 - 49765076
Alignment:
22 gggatccaaacacttttattttgatgaattttcttaggctgatgatgatattccaggacccttctc--tccagctatgcacatggaacggaggagactag 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||  ||||||||||||||||||||||||||||||||    
49764852 gggatccaaacacttttattttgatgaattttcttaggctgatgatgatatcccaggacccttctctctccagctatgcacatggaacggaggagactag 49764951  T
120 agagattgcggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtacatgatctactc 219  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49764952 agagattccggtaacaattgcaagtactgctgattaggtgcaaacgagagccattgaataaatgccacactctatattgctgctagtacatgatctactc 49765051  T
220 attgaatgccaatcgaggggaccac 244  Q
    |||||||||||||||||||||||||    
49765052 attgaatgccaatcgaggggaccac 49765076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University