View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_70 (Length: 241)
Name: NF9836_low_70
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_70 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 4325427 - 4325642
Alignment:
| Q |
17 |
aacttagacataagcacttatatgataaacacaagtatgctataagcgcctacttgaactgttcatccttaagaatctcaaagtcatagcattgagatga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4325427 |
aacttagacataagcacttatatgataaacacaagtatgctataagcgcctacttgaactgttcatccttaagaatctcaaagtcatagcattgagatga |
4325526 |
T |
|
| Q |
117 |
caaaattctcaaatcacatttttgcattgtttcacaatgattcaggtaaaagactgggttgacagtatttcgagagattggaagtttagaagaattatcc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4325527 |
caaaattctcaaatcacatttttgcattgtttcacgatgattcaggtaaaagactgggttgacagtatttcgagagattggaagtttagaagaattatcc |
4325626 |
T |
|
| Q |
217 |
cagctcacttctctgc |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4325627 |
cagctcacttctctgc |
4325642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 29170059 - 29170091
Alignment:
| Q |
17 |
aacttagacataagcacttatatgataaacaca |
49 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
29170059 |
aacttatacataagcacttatatgataaacaca |
29170091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University