View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_74 (Length: 240)
Name: NF9836_low_74
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 26787589 - 26787362
Alignment:
| Q |
1 |
gatgatgctggtcctacttacgtttgggggactaacattagcgtggaggatgttaacgatgcgattcagaggtttttgaagcattttagagaaaaatctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26787589 |
gatgatgctggtcctacttacgtttggggtactaacattagcgtggaggatgttaacgatgcgattcagaggtttttgaagcattttagagaaaaatctg |
26787490 |
T |
 |
| Q |
101 |
cttctcaaggtggtgatgatgatttggatatggatttggatattgaagggaagtatgagaaattgatcaaacaggttattgaattggaaggtgagtctat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26787489 |
cttctcaaggcggtgatgatgatttggatatggatttggatattgaagggaagtatgagaaattgatcaaacaggttattgaattggaaggtgagtctat |
26787390 |
T |
 |
| Q |
201 |
tgatgttgatgcacgtgatgtatttgat |
228 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
26787389 |
tgatgttgatgcacgtgatgtgtttgat |
26787362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University