View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_84 (Length: 224)
Name: NF9836_low_84
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 16694064 - 16694262
Alignment:
| Q |
17 |
cagaagcatgctactgaatcaggttttcttttcttctttgaggattatttgacttatcatttcatagcatattgaacttagatcattctaattaaacatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16694064 |
cagaagcatgctactgaatcaggttttcttttcttctttgaggattatttgacttatcatttcatagcatattgaacttagatcattctaattaaacatg |
16694163 |
T |
 |
| Q |
117 |
tgaattatttacgactaacaggaattgcatgaagctggaagtacagatttttgtttgccgggaacctcaccaattccagagtggtttcaacaccaaact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16694164 |
tgaattatttacgactaacaggaattgcatgaagctggaagtacagatttttgtttgccaggaacctcaccgattccagagtggtttcaacaccaaact |
16694262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 160
Target Start/End: Original strand, 31908117 - 31908153
Alignment:
| Q |
124 |
tttacgactaacaggaattgcatgaagctggaagtac |
160 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31908117 |
tttatgactaacaggaattgcatgaagctggaagtac |
31908153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University