View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_89 (Length: 214)
Name: NF9836_low_89
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_89 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 2 - 200
Target Start/End: Complemental strand, 24185836 - 24185638
Alignment:
| Q |
2 |
tcctcgtgttttttcttgctgagagtgtggcgtaacttcttggccttctcctttactttggtgataactgatttcttctgattctggccatggtcttctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24185836 |
tcctcgtgttttttcttgctgagagtgtggcgtaacttcttggccttctcctttactttggtgataactgatttcttctgattctggccatggtcttctt |
24185737 |
T |
|
| Q |
102 |
ctgagtcatgatgcttcaacctctggaagaaaggagaggatggggaagaacagtttgaggaagagaaggatttgcttggtgacagctttggctttgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24185736 |
ctgagtcatgatgcttcaacctctggaagaaaggagaggatggggaagaacagtttgaggaagaggaggatttgcttggtgacagctttggctttgatg |
24185638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University