View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9836_low_90 (Length: 213)
Name: NF9836_low_90
Description: NF9836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9836_low_90 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 17 - 158
Target Start/End: Original strand, 38096829 - 38096967
Alignment:
| Q |
17 |
tagggatggatgaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaannnnnnnnagtgaaagagaaatgcataccgcttatgaaatcatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096829 |
tagggatggatgaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaaggggg---agtgaaagagaaatgcataccgcttatgaaatcatc |
38096925 |
T |
 |
| Q |
117 |
caaagagagtaggaaatgatggtgatctggtctggtctggtc |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38096926 |
caaagagagtaggaaatgatggtgatctggtatggtctggtc |
38096967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University