View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9837_high_8 (Length: 245)
Name: NF9837_high_8
Description: NF9837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9837_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 34 - 229
Target Start/End: Complemental strand, 6227061 - 6226867
Alignment:
| Q |
34 |
attgattgacatgaaaattgtgattgcaaaatagtgaaaacttatatggggagataactaatagaaaaaacggaaaagcgaaatccttactgtcatgtgc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227061 |
attgattgacatgaaaattgtgattgcaaaatagtgaaaacttatatggg-agataactaatagaaaaaacggaaaagcgaaatccttactgtcatgtgc |
6226963 |
T |
|
| Q |
134 |
aaaccaccatgagggatcgcgaacagaggagatcgtagtgccgacgtctccacaccgtgacttcatcgttttcatctcaattgctgccatctttcc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6226962 |
aaaccaccatgagggatcgcgaacagaggagatcgtagtgccgacgtctccacaccgtgacttcatcgttttcatctcaattgctgccatctttcc |
6226867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 6227110 - 6227081
Alignment:
| Q |
1 |
actcaagctcattgccgaaacctgtagata |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6227110 |
actcaagctcattgccgaaacctgtagata |
6227081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University