View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9837_high_9 (Length: 233)
Name: NF9837_high_9
Description: NF9837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9837_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 47684951 - 47684749
Alignment:
| Q |
15 |
caaaggaaacacaggtgcaagagtgcaagtgtaaagagaaagcaatgaatgaaacccttttgagttctcttcttgcaatgatgctacaacacagtgacag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47684951 |
caaaggaaacacaggtgcaagagtgcaagtgtaaagagaaagcaatgaatgaaacccttttgagttctcttcttgcaatgatgctacaacacagtgacag |
47684852 |
T |
 |
| Q |
115 |
aagaagaagat---agtatttgaaagagtgtgact--nnnnnnnnnnnnnnnncattggggttggggcctttctttcttgtctctcactctgcaacgtta |
209 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47684851 |
aagaagaagatagtagtatttgaaagagtgtgactagagagagagagagagagcattggggttggggcctttctttcttgtctctcactctgcaacgtta |
47684752 |
T |
 |
| Q |
210 |
cgc |
212 |
Q |
| |
|
||| |
|
|
| T |
47684751 |
cgc |
47684749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University