View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9837_low_14 (Length: 264)
Name: NF9837_low_14
Description: NF9837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9837_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 6227157 - 6227410
Alignment:
| Q |
1 |
agttattcgtgttgattatacacctccgattgcgggtatgtttgtaccctcatacctgaaggcttttgtgaaagagatgactactctgtcctccgatgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227157 |
agttattcgtgttgattatacacctccgattgcgggtatgtttgtacctccatacctgaaggcttttgtgaaagagatgactactctgtcctccgatgac |
6227256 |
T |
|
| Q |
101 |
aagaacaagaattcttttctggtagtcgtaggcaacctcccgcccgagacaaggaaccatgatttgcttcaacttttccagccttttggtcatgtcatcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227257 |
aagaacaagaattcttttctggtagtaggaggcaacctcccacccgagacaaggaaccatgatttgcttcaacttttccagccttttggtcatgtcatcg |
6227356 |
T |
|
| Q |
201 |
gtgccgatgttgctattgctcatcacactggccttagtggccgttttgcctttg |
254 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6227357 |
gtgccgatattgctattgctcaacacactggccttagtggccgttttgcctttg |
6227410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University