View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9837_low_20 (Length: 232)
Name: NF9837_low_20
Description: NF9837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9837_low_20 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 35409616 - 35409847
Alignment:
| Q |
1 |
aatcacagccatgaactttgttgcctgaaataagcttggcagtgatgatagaaagtatctctgcggatccttgacaaaggccgcgtgatcaggaacctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409616 |
aatcacagccatgaactttgttgcctgaaataagcttggcagtgatgatagaaagtatctctgcggatccttgacaaaggccgcgtgatcaggaacctcc |
35409715 |
T |
|
| Q |
101 |
tcattaggaattaattttcgcattaattgtggccggattggaacatatccaccataggggtattgactgaagttcaagacagcatgttgcgctgatacag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409716 |
tcattaggaattaattttcgcattaattgtggccggattggaacatatccaccataggggtattgactgaagttcaagacagcatgttgcgctgatacag |
35409815 |
T |
|
| Q |
201 |
tccagataatggtggtaagcaaggagatgaga |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35409816 |
tccagataatggtggtaagcaaggagatgaga |
35409847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 58
Target Start/End: Original strand, 35408255 - 35408311
Alignment:
| Q |
2 |
atcacagccatgaactttgttgcctgaaataagcttggcagtgatgatagaaagtat |
58 |
Q |
| |
|
||||||||||||||| || | ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
35408255 |
atcacagccatgaaccttttcgcctgaaataaacttggcagtgatgacagaaagtat |
35408311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University