View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9837_low_21 (Length: 204)

Name: NF9837_low_21
Description: NF9837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9837_low_21
NF9837_low_21
[»] chr3 (1 HSPs)
chr3 (95-187)||(42129350-42129442)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 95 - 187
Target Start/End: Original strand, 42129350 - 42129442
Alignment:
95 cgacggtttcgttgtcgactgcgatgcttttgctgcagcaatgacccatggttaggtagcgtaggtcggcggtagtggattgttatcggtggt 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42129350 cgacggtttcgttgtcgactgcgatgcttttgctgcagcaatgacccatggttaggtagcgtaggtcggcggtagtggattgttatcggtggt 42129442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University