View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9838_low_11 (Length: 331)
Name: NF9838_low_11
Description: NF9838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9838_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 1 - 141
Target Start/End: Complemental strand, 47254603 - 47254463
Alignment:
| Q |
1 |
aatctgatgctgtccgtttggtttatggtttcaattttgataaaccagatttcagcaaaatcaatgcaaaatctgattatgaagagatttttgagcctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47254603 |
aatctgatgctgtccgtttggtttatggtttcaattttgataaaccagatttcagcaaaatcaatgcaaaatctgattatgaagagatttttgagtctta |
47254504 |
T |
|
| Q |
101 |
tgcatctgatatctccaactatcttcgcacaatggaggtaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47254503 |
tgcatctgatatctccaactatcttcgcacaatggaggtaa |
47254463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 193 - 313
Target Start/End: Complemental strand, 47254412 - 47254292
Alignment:
| Q |
193 |
aattattggtttgattgtttctcaggttcagaaaaagagaagaccaatgattggttatattgagaaagttcaaagaggtgtcactgctaatatgagaggg |
292 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47254412 |
aatttttggtttgattgtttctcaggttcagaaaaagagaagaccaatgattggttatattgagaaagttcaaagaggtgttactgctaatatgagaggg |
47254313 |
T |
|
| Q |
293 |
atactggttgattggttggtt |
313 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47254312 |
atactggttgattggttggtt |
47254292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 222 - 270
Target Start/End: Complemental strand, 47243126 - 47243078
Alignment:
| Q |
222 |
agaaaaagagaagaccaatgattggttatattgagaaagttcaaagagg |
270 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| ||||||||||| |
|
|
| T |
47243126 |
agaaaaagagaagaccaatgtttggttatatggagaatgttcaaagagg |
47243078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 203 - 270
Target Start/End: Complemental strand, 47249974 - 47249907
Alignment:
| Q |
203 |
ttgattgtttctcaggttcagaaaaagagaagaccaatgattggttatattgagaaagttcaaagagg |
270 |
Q |
| |
|
|||| ||||| |||| | ||||||||||||||||||||| |||||||| ||||||| ||||| ||||| |
|
|
| T |
47249974 |
ttgaatgtttatcagatgcagaaaaagagaagaccaatggttggttatcttgagaatgttcagagagg |
47249907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 94 - 141
Target Start/End: Complemental strand, 47250107 - 47250060
Alignment:
| Q |
94 |
agccttatgcatctgatatctccaactatcttcgcacaatggaggtaa |
141 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
47250107 |
agccttatgtatctgatatctctgattatcttcgcacaatggaggtaa |
47250060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University