View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9838_low_18 (Length: 242)
Name: NF9838_low_18
Description: NF9838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9838_low_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 93 - 242
Target Start/End: Complemental strand, 54890340 - 54890191
Alignment:
| Q |
93 |
tgtataaataaataagcttttatgtttagccaccctaataatatatgttgaactacccaaacaagtatatttgccaaaaatttagtagaaacataaaaga |
192 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54890340 |
tgtataaataagtaagcttttatgtttagccaccctaataatatatgttgaactacccaaacaagtatatttgccaaaaatttagtagaaacataaaaga |
54890241 |
T |
 |
| Q |
193 |
taaaaaattattatttgattggaaattgtatttctcgtgttttgacactt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54890240 |
taaaaaattattatttgattggaaattgtatttctcgtgttttgacactt |
54890191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University