View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_high_41 (Length: 276)
Name: NF9839A_high_41
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 103 - 270
Target Start/End: Complemental strand, 32790516 - 32790349
Alignment:
| Q |
103 |
atacaatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32790516 |
atacaatcctagatgcgtcaaattcgagctgaaattggtgctgtatccaaagctaatggcgatcgcatgaggaaaccgaagggcgacaggttatttctta |
32790417 |
T |
|
| Q |
203 |
tttacctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatatcagtcga |
270 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32790416 |
tttgcctgtttaattttccagtctttttgcacgatgttgatatacatacaagtgttcatgtcagtcga |
32790349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 163 - 232
Target Start/End: Complemental strand, 48283734 - 48283665
Alignment:
| Q |
163 |
gatcgcatgaggaaaccgaagggcgacaggttatttcttatttacctgtttaattttccagtctttttgc |
232 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
48283734 |
gatcgcatgaggaaaccaaagggcgacaggttatttcttatttacttgtttaatttcccagtctttttgc |
48283665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 161
Target Start/End: Complemental strand, 48284308 - 48284253
Alignment:
| Q |
106 |
caatcctagatgcgtcaaattcgagctgaaattgatgctgtatccaaagctaatgg |
161 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||| |||||||||||||||| |||| |
|
|
| T |
48284308 |
caatcctagatgcgacaaattcgagcagagattggtgctgtatccaaagctgatgg |
48284253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University