View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_high_51 (Length: 247)
Name: NF9839A_high_51
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_high_51 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 224
Target Start/End: Complemental strand, 14783 - 14573
Alignment:
| Q |
14 |
ttctacaatagtgctataaataactaaaacaaacaatcaacaatgaatatcaaaataacatgaacaacttataatttaaactacactatattgactttga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14783 |
ttctacaatagtgctataaataactaaaacaaacaatcaacaatgaatatcaaaataacatgaacaacttataatttaaactacactatattgactttga |
14684 |
T |
 |
| Q |
114 |
aacaccaattcaaatcaatcttaccacgacactgggacataaaattttcttaatcagctttgagtctccacccatatgcagcacgttccatattcttcta |
213 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14683 |
aacaccaattcaaatcaatcttaccacaacactgggacataaaattttcttaatcagctttgactctccacccatatgcagcacgttccatattcttcta |
14584 |
T |
 |
| Q |
214 |
ttaggtgttat |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
14583 |
ttaggtgttat |
14573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University