View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_109 (Length: 345)
Name: NF9839A_low_109
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_109 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 339
Target Start/End: Original strand, 29740995 - 29741316
Alignment:
| Q |
18 |
acatcaccttccacaacaaaccaccaattccaacacaacccattgatcactcacacctatcacaactcctctcaaaacccaactccgattgggtcatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29740995 |
acatcaccttccacaacaaaccaccaattccaacacaacccattgatcactcacacctctcacaactcctctcaaaacccaactccgattgggtcatttt |
29741094 |
T |
 |
| Q |
118 |
actcaaccaccaactccacaccaacaaattactactcacacccccttcactctcaaccattttccaaaacattcataacccattacactccatcaaattc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29741095 |
actcaaccaccaactccacaccaacaaattactactcacacccccctcactctcaactattttccaaaacattcataacccattacactccatcaaattc |
29741194 |
T |
 |
| Q |
218 |
tacacatgggtttcatccatcaactcttcattggtaaacaactcttccattcaccgcattttaggtaacaccttgtaccgaaatggtcctgttgttttat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29741195 |
tacacatgggtttcatccatcaactcttcattggtaaacaactcttccattcaccgcattttaggtaacaccttgtaccgaaatggtcctgttgttttat |
29741294 |
T |
 |
| Q |
318 |
ctgctgagtttcttaatgatgt |
339 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29741295 |
ctgctgagtttcttaatgatgt |
29741316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University