View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_110 (Length: 344)
Name: NF9839A_low_110
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_110 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 17 - 325
Target Start/End: Original strand, 46333302 - 46333607
Alignment:
| Q |
17 |
acatcaattccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgttctgtccgcacttgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46333302 |
acatcaattccaccgggactacgcgggcggatggagaaacggtaattggctgacaccttgcttgttatattgaaatgtttgatgttctgtccacacttgg |
46333401 |
T |
|
| Q |
117 |
acacgtgctttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggaatcagaaggttttgccatttatgatgcaatgatgcagat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46333402 |
acacgtgctttgtatggttcaactcatgcatttattgtttttgactttaggtggcgatggagtcagaaggttttgccatttatgatgcaatgatgcagat |
46333501 |
T |
|
| Q |
217 |
gaaaacaactcaggtttgtttcttctcactgacaatgcacttcaaataattttttacttgtttttcttgttgacttttgttgatgattgtacttgacagt |
316 |
Q |
| |
|
||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46333502 |
gaa---aactgaggtttgtttcttctcactgacaatgcacttcaaataattttttacttgtttttcttgttgacttttgttgatgattgtacttgacagt |
46333598 |
T |
|
| Q |
317 |
aatatgatg |
325 |
Q |
| |
|
||||||||| |
|
|
| T |
46333599 |
aatatgatg |
46333607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University