View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9839A_low_116 (Length: 338)

Name: NF9839A_low_116
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9839A_low_116
NF9839A_low_116
[»] chr6 (2 HSPs)
chr6 (154-234)||(26287204-26287286)
chr6 (7-150)||(26287509-26287639)


Alignment Details
Target: chr6 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 154 - 234
Target Start/End: Original strand, 26287204 - 26287286
Alignment:
Q  154 gagtgtcgtgcatggggc--tctcacacccttgattgcattttttgtaatcattattgatggggattgcttgtatcacaagga 234  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||    
T  26287204 gagtgtcgtgcatggggcgctctcacacccttgattgcattttttgtaaccattattgatggggactgcttgtatcacaagga 26287286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 7 - 150
Target Start/End: Original strand, 26287509 - 26287639
Alignment:
Q  7 tttggagggttttggtgtgagtatcgggggatctgtgtttgagatttgtttccgtggctattcacaatggagtttgaattttttgactcatgttcggttt 106  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||    |||          ||||||||||||| ||||||||||||||| |||||    
T  26287509 tttggagggttttggtgtgagtatcgggggatatgtgtttgagatttg----cgtt---------aatggagtttgaagtttttgactcatgtttggttt 26287595  T
Q  107 ctgctatcatgtgggagttcaactttgatttagtgttggcttta 150  Q
     |||| |  |||||||||||||||||||||||||||||||||||    
T  26287596 ttgctgttgtgtgggagttcaactttgatttagtgttggcttta 26287639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University