View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_143 (Length: 314)
Name: NF9839A_low_143
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_143 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 122 - 302
Target Start/End: Original strand, 16401724 - 16401904
Alignment:
| Q |
122 |
ccataaattaaaaccacttagagaaattgatgggcataaacaaaagacttaataaacaaatggaattttctaatacctgataaaatttaatgattcacat |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16401724 |
ccataaattaataccacttagagaaattgattgtcataaacaaaagacttaataaacaaatggaattttctaatacctgataaaatttaatgatccacat |
16401823 |
T |
|
| Q |
222 |
gtgcgaaacttttaatatgtgtttcaaactataaagagctccctaggaaacctgcatcaacctcaaaatatcgaccaccgt |
302 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16401824 |
ctgcaaaacttttaatatgtgtttcaaactataaagagctccctaggaaacctgcctcaacctcaaaatatcgaccaccgt |
16401904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University