View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_153 (Length: 307)
Name: NF9839A_low_153
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_153 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 37 - 281
Target Start/End: Complemental strand, 40311961 - 40311716
Alignment:
| Q |
37 |
tgagttcaaaaaacatgaagagagagaaagatgagacagtgatctgagctgaaacagtgggaataaagtcagggannnnnnnnnnnnnnnnnnntttgta |
136 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40311961 |
tgagttcaaaaaacttgaagagagagaaagatgagacagtgatctgagctgaaacagtgggaataaagtcagggaagagagagaagagagagagtttgta |
40311862 |
T |
|
| Q |
137 |
ttgcacgcatatcgatttctcaaaacagagctttcttttttagttcaattcatttacgtaattgtccttgttgtttgtttctaatgacatg-ttacatag |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40311861 |
ttgcacgcatatcgatttctcaaaacagagctttcttttttagttcaattcatttacgtaattgtccttgttgtttgtttctaatgacatgtttacatag |
40311762 |
T |
|
| Q |
236 |
ccctacactactcatgtcattttcaacgttcaccacctttgttttt |
281 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40311761 |
ccctacactactcatgtcattttcaacattcaccacctttgttttt |
40311716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University