View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_159 (Length: 303)
Name: NF9839A_low_159
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_159 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 110 - 246
Target Start/End: Complemental strand, 15827348 - 15827214
Alignment:
| Q |
110 |
cttgactcatatgctttaacaatttcatgaagaaatcacaatagtctagcttgtctatcagcagaagtattgaggcatatcaagtgtcaagtaaaaaggt |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15827348 |
cttgactcatatgctt-aacaatttcatgaagaaatcacaagagtctagcttgtctatcagcagaagtattgaggcatatcaggtgtcaagtaaaaaggt |
15827250 |
T |
|
| Q |
210 |
atagccttatctcaaatgcaatcatagatcacctaaa |
246 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
15827249 |
atagtcttatctc-aatgcaatcatagatcacctaaa |
15827214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 13 - 117
Target Start/End: Complemental strand, 15827599 - 15827495
Alignment:
| Q |
13 |
catcaaaatacaaaatgttggttatatcataagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacactt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15827599 |
catcaaaatacaaaatgttggttatatcatgagaaattccacttgcgagtcatatcccaatgttcaaaatgaaattttttatgagagaaaccatacactt |
15827500 |
T |
|
| Q |
113 |
gactc |
117 |
Q |
| |
|
||||| |
|
|
| T |
15827499 |
gactc |
15827495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University