View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_173 (Length: 295)
Name: NF9839A_low_173
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_173 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 139 - 289
Target Start/End: Complemental strand, 31114667 - 31114516
Alignment:
| Q |
139 |
gtccatgaatcgtccaaagtgaacccagttcactgtgtttatgggatacaagcttctatcatcaatgcagataatggagagtgagtggcataatgggatc |
238 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31114667 |
gtccatgaatcgaccaaagtgaacccagttcactgtgtttctgggatacaagcttctatcatcaatgcagataatggagagtgagtggcataatgggacc |
31114568 |
T |
 |
| Q |
239 |
cacctctttgaatggacattggttct-aaagcttatttgattgggagaaaag |
289 |
Q |
| |
|
|| ||||| ||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31114567 |
caactcttagaaaggacattggttctaaaagcttatttgattgggagaaaag |
31114516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 13 - 71
Target Start/End: Complemental strand, 31114739 - 31114681
Alignment:
| Q |
13 |
atggacatcaaccaaggatagataaagatgacgtcgttttgatgcttcaacccatttat |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114739 |
atggacatcaaccaaggatagataaagatgacgtcgttttgatgcttcaacccatttat |
31114681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 112 - 224
Target Start/End: Complemental strand, 31088611 - 31088499
Alignment:
| Q |
112 |
ttgagagtgggggttgaacataattgcgtccatgaatcgtccaaagtgaacccagttcactgtgtttatgggatacaagcttctatcatcaatgcagata |
211 |
Q |
| |
|
||||||||| |||||||||||||||| |||| ||||| | |||||||||||| ||| |||||||| | |||| |||||| ||||||||| || || | |
|
|
| T |
31088611 |
ttgagagtgtgggttgaacataattgtatccacgaatcaacgaaagtgaacccacttctctgtgtttctttgatagaagcttatatcatcaaagcggaca |
31088512 |
T |
 |
| Q |
212 |
atggagagtgagt |
224 |
Q |
| |
|
| |||||||||| |
|
|
| T |
31088511 |
acagagagtgagt |
31088499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University