View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_179 (Length: 292)
Name: NF9839A_low_179
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_179 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 25 - 244
Target Start/End: Complemental strand, 6179713 - 6179506
Alignment:
| Q |
25 |
tagagatagatgcaagaaacattttgagagtgtgggtttttgtgtggatgagagaaagagtttgatgctagaaacaacgagagatttgtggctctaattt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6179713 |
tagagatagatgcaagaaacattttgagagt------------gtggatgagagaaagagtttgatgctagaaacaacgagagatttgtggctctaattt |
6179626 |
T |
|
| Q |
125 |
tgtaagagtgagaaagaaagtgtgagtgagaaaatcaacactcacaaaataaagcttagtagtataatgtgttcgtatatataagtggcaagaaaatgag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6179625 |
tgtaagagtgagaaagaaagtgtgagtgagaaaatcaacactcacaaaataaagcttagtagtataatgtgttcgtatatataagtggcaagaaaatgag |
6179526 |
T |
|
| Q |
225 |
attgagatagaggttctagg |
244 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6179525 |
attgagatagaggttctagg |
6179506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University