View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_181 (Length: 291)
Name: NF9839A_low_181
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_181 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 27 - 291
Target Start/End: Original strand, 27203010 - 27203274
Alignment:
| Q |
27 |
acatcatcgtcttatatgtttaatgatgtgtttaaggttaatttggcactgctgtgttttaagaatgctgaaattattttggaccttttggtgtgttgtt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27203010 |
acatcatcgtcttatatgtttaatgatgtgtttaaggttaatttggcactgctgtgttttaagaatgctgaaattattttggcccttttggtgtgttgtt |
27203109 |
T |
|
| Q |
127 |
tacagttcagggtaatgatggtccctcagttgatgctgcttttaagagcgatttggttaacatgagaacttttcacatggaatatgattcatgcagtgtg |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27203110 |
tacagttcagggtaatgatggtccctcggttgatgctgctgttaagggcgatttggttaacatgaggacttttcacatggaatatgattcatgcagtgtg |
27203209 |
T |
|
| Q |
227 |
agttcgtataaaatttatcaattttgctattaatttttgcttttggtcactgttctagagtacca |
291 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27203210 |
agttcgtataaaatttatcaattttcctattaatttttgcttttggtcactgttctagagtacca |
27203274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 176 - 230
Target Start/End: Original strand, 16421718 - 16421772
Alignment:
| Q |
176 |
gatttggttaacatgagaacttttcacatggaatatgattcatgcagtgtgagtt |
230 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||| |||| ||||||||||||||| |
|
|
| T |
16421718 |
gatttggttaacttgaggacgtttcacatggaatttgatgcatgcagtgtgagtt |
16421772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University